ID: 1176140779_1176140793

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1176140779 1176140793
Species Human (GRCh38) Human (GRCh38)
Location 20:63544158-63544180 20:63544189-63544211
Sequence CCAACCACCCCAAGGTCAAGGGC TGGTGGGGGACAGAGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 191} {0: 1, 1: 1, 2: 22, 3: 209, 4: 2159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!