ID: 1176140783_1176140796

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1176140783 1176140796
Species Human (GRCh38) Human (GRCh38)
Location 20:63544167-63544189 20:63544201-63544223
Sequence CCAAGGTCAAGGGCCACTGACCT GAGGCAGGAGGGGCCGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 192} {0: 1, 1: 0, 2: 8, 3: 73, 4: 697}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!