ID: 1176143289_1176143296

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1176143289 1176143296
Species Human (GRCh38) Human (GRCh38)
Location 20:63554306-63554328 20:63554320-63554342
Sequence CCGGGCCAGGGGAGCCAAGGGGA CCAAGGGGAGTGTGGTGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 401} {0: 1, 1: 0, 2: 3, 3: 42, 4: 505}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!