ID: 1176145476_1176145487

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1176145476 1176145487
Species Human (GRCh38) Human (GRCh38)
Location 20:63563487-63563509 20:63563524-63563546
Sequence CCAGCTGCAGGGAGCCGTAGGGG AGGCAGCGTCTCCCGGTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 182} {0: 1, 1: 0, 2: 0, 3: 8, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!