ID: 1176151225_1176151231

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1176151225 1176151231
Species Human (GRCh38) Human (GRCh38)
Location 20:63592032-63592054 20:63592056-63592078
Sequence CCGGGCGTACTGCTCCCGCGAGC GTCCATCTGGCACTTGTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31} {0: 1, 1: 0, 2: 1, 3: 7, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!