ID: 1176178769_1176178796

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1176178769 1176178796
Species Human (GRCh38) Human (GRCh38)
Location 20:63740178-63740200 20:63740227-63740249
Sequence CCGCCGGGGCTGCGCCGGGCGGC CTGGGGGCGGGGCCGGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 248} {0: 3, 1: 15, 2: 141, 3: 862, 4: 3744}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!