ID: 1176178798_1176178802

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1176178798 1176178802
Species Human (GRCh38) Human (GRCh38)
Location 20:63740239-63740261 20:63740256-63740278
Sequence CCGGGGGCGGGGCCGCGCCGTCC CCGTCCACACCGGCCGCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 49, 4: 328} {0: 1, 1: 0, 2: 1, 3: 12, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!