ID: 1176194392_1176194404

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1176194392 1176194404
Species Human (GRCh38) Human (GRCh38)
Location 20:63830821-63830843 20:63830838-63830860
Sequence CCGCCCCCGCGCGCCCCGCCCCG GCCCCGCGCCGCCGGCCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 113, 3: 583, 4: 2779} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!