ID: 1176194394_1176194404

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1176194394 1176194404
Species Human (GRCh38) Human (GRCh38)
Location 20:63830825-63830847 20:63830838-63830860
Sequence CCCCGCGCGCCCCGCCCCGCGCC GCCCCGCGCCGCCGGCCTGGGGG
Strand - +
Off-target summary {0: 2, 1: 12, 2: 96, 3: 463, 4: 2141} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!