ID: 1176215977_1176215980

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1176215977 1176215980
Species Human (GRCh38) Human (GRCh38)
Location 20:63947942-63947964 20:63947955-63947977
Sequence CCTGGGAGGGGCAGCCTCTGGGG GCCTCTGGGGAGGCTCAATATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!