ID: 1176219791_1176219799

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1176219791 1176219799
Species Human (GRCh38) Human (GRCh38)
Location 20:63964471-63964493 20:63964510-63964532
Sequence CCTGGAGCTCTCATCTTACTGTG TCCTCCTCAGGCGGGGACGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 169} {0: 1, 1: 0, 2: 0, 3: 20, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!