ID: 1176220559_1176220573

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1176220559 1176220573
Species Human (GRCh38) Human (GRCh38)
Location 20:63967572-63967594 20:63967615-63967637
Sequence CCACCGGCGGCTGCACAGGCCCA ACACGAGGGCACCGGGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 188} {0: 1, 1: 0, 2: 0, 3: 7, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!