ID: 1176231307_1176231320

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1176231307 1176231320
Species Human (GRCh38) Human (GRCh38)
Location 20:64034403-64034425 20:64034452-64034474
Sequence CCTTCCCTGTGGTTCTGGGGACC GGGACCTGCCACCCCTGTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 330} {0: 1, 1: 0, 2: 0, 3: 6, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!