ID: 1176241193_1176241207

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1176241193 1176241207
Species Human (GRCh38) Human (GRCh38)
Location 20:64076710-64076732 20:64076751-64076773
Sequence CCACCTTCCCATGGGTAGCCCTG TTCTGGCCTCCCGGGTGTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 257} {0: 1, 1: 1, 2: 1, 3: 10, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!