ID: 1176243140_1176243149

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1176243140 1176243149
Species Human (GRCh38) Human (GRCh38)
Location 20:64084220-64084242 20:64084241-64084263
Sequence CCTCCCGCCCTGCGGAGGGAGGA GAGGGCGTCCCGTCGGTGCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 226} {0: 1, 1: 0, 2: 0, 3: 6, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!