ID: 1176304463_1176304476

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1176304463 1176304476
Species Human (GRCh38) Human (GRCh38)
Location 21:5115922-5115944 21:5115965-5115987
Sequence CCACGCCCTCTCAAGGCGGTAGA CAGTGGGTGGGGAGGGCCGAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 5, 3: 63, 4: 591}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!