ID: 1176310237_1176310248

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1176310237 1176310248
Species Human (GRCh38) Human (GRCh38)
Location 21:5145453-5145475 21:5145489-5145511
Sequence CCCACAGCCCAGACGCGGGACAC AGCATCTCTGCCAGGGCTCCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 91} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!