ID: 1176326897_1176326904

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1176326897 1176326904
Species Human (GRCh38) Human (GRCh38)
Location 21:5509151-5509173 21:5509201-5509223
Sequence CCCACCTCGGCACAGTCACCTGT AAGTAGACACAAATCCCCATGGG
Strand - +
Off-target summary {0: 13, 1: 0, 2: 0, 3: 18, 4: 115} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!