ID: 1176334679_1176334681

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1176334679 1176334681
Species Human (GRCh38) Human (GRCh38)
Location 21:5584971-5584993 21:5584984-5585006
Sequence CCATGGTTGGTGTGAGTAGGCTT GAGTAGGCTTGGACACCTGCAGG
Strand - +
Off-target summary {0: 5, 1: 1, 2: 0, 3: 9, 4: 105} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!