ID: 1176359456_1176359461

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1176359456 1176359461
Species Human (GRCh38) Human (GRCh38)
Location 21:5982811-5982833 21:5982828-5982850
Sequence CCTGCAGGTGGCACATATGGGTG TGGGTGGGTCGCAGCGGTGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 7, 3: 36, 4: 184} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!