ID: 1176382822_1176382825

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1176382822 1176382825
Species Human (GRCh38) Human (GRCh38)
Location 21:6121527-6121549 21:6121555-6121577
Sequence CCTGCATCCTGGCACGGACACTG TACAGCAATAACTTCAGAGGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 15, 4: 170} {0: 2, 1: 0, 2: 3, 3: 11, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!