ID: 1176384686_1176384699

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1176384686 1176384699
Species Human (GRCh38) Human (GRCh38)
Location 21:6133484-6133506 21:6133537-6133559
Sequence CCCAAGCCTGCACCGGAGCCAGC GCGTGACGTCTGGCACCTGGCGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 3, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!