ID: 1176384690_1176384699

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1176384690 1176384699
Species Human (GRCh38) Human (GRCh38)
Location 21:6133496-6133518 21:6133537-6133559
Sequence CCGGAGCCAGCCAGTTCCGGCTG GCGTGACGTCTGGCACCTGGCGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 3, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!