ID: 1176386473_1176386486

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1176386473 1176386486
Species Human (GRCh38) Human (GRCh38)
Location 21:6140644-6140666 21:6140689-6140711
Sequence CCAGGAGGGTGGACTCTGGCAGG GCGTGTGCCCGTGTGTGCTTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 24, 4: 325} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!