ID: 1176391461_1176391464

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1176391461 1176391464
Species Human (GRCh38) Human (GRCh38)
Location 21:6218160-6218182 21:6218180-6218202
Sequence CCTGCCTCTTTCTCCTTAGACTA CTAGCGCACTGTCACTGAGCTGG
Strand - +
Off-target summary No data {0: 7, 1: 2, 2: 2, 3: 17, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!