ID: 1176393780_1176393786

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1176393780 1176393786
Species Human (GRCh38) Human (GRCh38)
Location 21:6242578-6242600 21:6242607-6242629
Sequence CCCACCCTAAGGGTTTAATTACA CTCCTTATAGCATTACGCCCGGG
Strand - +
Off-target summary No data {0: 5, 1: 1, 2: 0, 3: 7, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!