ID: 1176396605_1176396609

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1176396605 1176396609
Species Human (GRCh38) Human (GRCh38)
Location 21:6271549-6271571 21:6271570-6271592
Sequence CCCATCGTCTTACCTCAAATGAT ATGTGAAAAGAGCTGGTTCCCGG
Strand - +
Off-target summary No data {0: 7, 1: 5, 2: 3, 3: 23, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!