|
Left Crispr |
Right Crispr |
| Crispr ID |
1176406138 |
1176406143 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
21:6368815-6368837
|
21:6368845-6368867
|
| Sequence |
CCAACACTCCCCCAACACAGGGA |
AACAAATTCCCTTTGTTTTATGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 2, 1: 0, 2: 7, 3: 55, 4: 458} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|