ID: 1176406355_1176406359

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1176406355 1176406359
Species Human (GRCh38) Human (GRCh38)
Location 21:6370395-6370417 21:6370416-6370438
Sequence CCCAGCTCAGTGACAGTGCGCTA TAGTCTAAGGAGAAAGAGGCCGG
Strand - +
Off-target summary {0: 7, 1: 2, 2: 6, 3: 12, 4: 80} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!