ID: 1176428711_1176428718

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1176428711 1176428718
Species Human (GRCh38) Human (GRCh38)
Location 21:6563628-6563650 21:6563650-6563672
Sequence CCCTGTGAGAGCCCCCGCAGGCT TGGCCCCCTTCTGCAGTCAGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 17, 4: 106} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!