ID: 1176436722_1176436733

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1176436722 1176436733
Species Human (GRCh38) Human (GRCh38)
Location 21:6679776-6679798 21:6679813-6679835
Sequence CCTTTTTCCTCTGTTCAATCCTG CGCAACTCTCAGGTCACCATTGG
Strand - +
Off-target summary No data {0: 13, 1: 2, 2: 0, 3: 5, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!