ID: 1176457813_1176457823

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1176457813 1176457823
Species Human (GRCh38) Human (GRCh38)
Location 21:6928759-6928781 21:6928780-6928802
Sequence CCCAGGCAGCCCACTGCCTTGCT CTCTGGGGACGGAGAGCAGAGGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 0, 3: 40, 4: 271} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!