ID: 1176460562_1176460565

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1176460562 1176460565
Species Human (GRCh38) Human (GRCh38)
Location 21:7004392-7004414 21:7004423-7004445
Sequence CCTGTAGTGTACTGAGATGAGCA CAAGTAGACACAAATCCCCATGG
Strand - +
Off-target summary No data {0: 14, 1: 3, 2: 1, 3: 17, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!