ID: 1176468341_1176468351

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1176468341 1176468351
Species Human (GRCh38) Human (GRCh38)
Location 21:7080197-7080219 21:7080247-7080269
Sequence CCATGGTTGGTGTGAGTAGGCTT ATAATCAACTGGGCCTTCAGTGG
Strand - +
Off-target summary No data {0: 9, 1: 1, 2: 0, 3: 17, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!