ID: 1176493515_1176493519

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1176493515 1176493519
Species Human (GRCh38) Human (GRCh38)
Location 21:7479771-7479793 21:7479792-7479814
Sequence CCCAGCTCAGTGACAGTGCGCTA TAGTCTAAGGAGAAAGAGGCAGG
Strand - +
Off-target summary No data {0: 8, 1: 0, 2: 1, 3: 20, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!