ID: 1176500556_1176500560

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1176500556 1176500560
Species Human (GRCh38) Human (GRCh38)
Location 21:7596964-7596986 21:7597009-7597031
Sequence CCAAGGTTGAAATGAAGGAAATA GAAGTCAGGTTACCTACAAATGG
Strand - +
Off-target summary {0: 15, 1: 1817, 2: 6580, 3: 2331, 4: 1609} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!