ID: 1176524285_1176524289

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1176524285 1176524289
Species Human (GRCh38) Human (GRCh38)
Location 21:7853688-7853710 21:7853715-7853737
Sequence CCATTGTCCATTTGTATATTTAG TTGGGAGAAAAAAGCCGAAAAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 23, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!