ID: 1176550099_1176550108

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1176550099 1176550108
Species Human (GRCh38) Human (GRCh38)
Location 21:8217215-8217237 21:8217233-8217255
Sequence CCCACCCCACGTCTCGTCGCGCG GCGCGCGCGTCCGCTGGGGGCGG
Strand - +
Off-target summary No data {0: 7, 1: 0, 2: 1, 3: 22, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!