ID: 1176550491_1176550498

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1176550491 1176550498
Species Human (GRCh38) Human (GRCh38)
Location 21:8218922-8218944 21:8218955-8218977
Sequence CCTCGACACAAGGGTTTGTCCGC GCGCGTGCGTGCGGGGGGCCCGG
Strand - +
Off-target summary No data {0: 3, 1: 2, 2: 0, 3: 25, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!