ID: 1176565978_1176565988

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1176565978 1176565988
Species Human (GRCh38) Human (GRCh38)
Location 21:8389592-8389614 21:8389605-8389627
Sequence CCCCGCCCGCCGGCGGTGCGTGT CGGTGCGTGTGGGAAGGCGTGGG
Strand - +
Off-target summary {0: 8, 1: 0, 2: 1, 3: 0, 4: 56} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!