ID: 1176568416_1176568442

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1176568416 1176568442
Species Human (GRCh38) Human (GRCh38)
Location 21:8398031-8398053 21:8398064-8398086
Sequence CCCGCGCCCCCGCCCCGGCGACG CGCGCGCGGGTCGGGGGGCGGGG
Strand - +
Off-target summary No data {0: 7, 1: 1, 2: 9, 3: 82, 4: 696}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!