ID: 1176573879_1176573889

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1176573879 1176573889
Species Human (GRCh38) Human (GRCh38)
Location 21:8433847-8433869 21:8433873-8433895
Sequence CCGCCGCCTTCTGCGTCGCGGGG GCCGGCGGGGTCCTCTGACGCGG
Strand - +
Off-target summary {0: 4, 1: 5, 2: 3, 3: 67, 4: 6006} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!