ID: 1176576679_1176576689

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1176576679 1176576689
Species Human (GRCh38) Human (GRCh38)
Location 21:8443705-8443727 21:8443742-8443764
Sequence CCGCGAGGCGTCCAGTGCGGTAA GAGAAGCCGGCGGGAGCCCCGGG
Strand - +
Off-target summary No data {0: 9, 1: 0, 2: 3, 3: 33, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!