ID: 1176596842_1176596845

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1176596842 1176596845
Species Human (GRCh38) Human (GRCh38)
Location 21:8705524-8705546 21:8705545-8705567
Sequence CCTAGAAAGGGGCTGTAGTGCTT TTCAGCTGTCCACTTTTGGGCGG
Strand - +
Off-target summary {0: 20, 1: 171, 2: 206, 3: 178, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!