ID: 1176597557_1176597562

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1176597557 1176597562
Species Human (GRCh38) Human (GRCh38)
Location 21:8761141-8761163 21:8761154-8761176
Sequence CCACGGGGAAGTTTTTCTTTTTC TTTCTTTTTCAGGAGGGAGGAGG
Strand - +
Off-target summary No data {0: 13, 1: 9, 2: 12, 3: 152, 4: 1537}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!