ID: 1176626701_1176626706

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1176626701 1176626706
Species Human (GRCh38) Human (GRCh38)
Location 21:9097488-9097510 21:9097521-9097543
Sequence CCCTCACATAGGATTCCAGAACA GGTCTGAATGACCCTCACATAGG
Strand - +
Off-target summary {0: 1414, 1: 2685, 2: 2809, 3: 1751, 4: 1058} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!