ID: 1176700080_1176700081

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1176700080 1176700081
Species Human (GRCh38) Human (GRCh38)
Location 21:10036053-10036075 21:10036075-10036097
Sequence CCATCTTCATAAATTAAAAAAGA AAACATAATAACTAGCGAAGTGG
Strand - +
Off-target summary No data {0: 7, 1: 0, 2: 2, 3: 5, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!