ID: 1176700341_1176700344 |
View in Genome Browser |
Spacer: 26 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1176700341 | 1176700344 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 21:10040332-10040354 | 21:10040381-10040403 |
| Sequence | CCTTATTTTCTTAACAACAACAG | TGCCGCATGCACCTAGAATCAGG |
| Strand | - | + |
| Off-target summary | {0: 6, 1: 1, 2: 1, 3: 26, 4: 335} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||