ID: 1176709201_1176709205

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1176709201 1176709205
Species Human (GRCh38) Human (GRCh38)
Location 21:10135197-10135219 21:10135222-10135244
Sequence CCTATGGGGAGGATGAGCAGTCA AGCCCACTGGGGTCCTGCGTAGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 8, 3: 23, 4: 182} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!