ID: 1176804006_1176804013

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1176804006 1176804013
Species Human (GRCh38) Human (GRCh38)
Location 21:13462624-13462646 21:13462671-13462693
Sequence CCTGAAACTCTCATCAGATAGAG AGTGTTATTTCAATAACATTGGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 1, 3: 33, 4: 426}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!